Stem-loop sequence ppe-MIR395k

AccessionMI0026113 (change log)
DescriptionPrunus persica miR395k stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention ppe-MIR395k
(13 sentences)

Stem-loop 
     ug         ug         u     -     aua      guu 
5' cc  gaguucccu  aacacuuca uggga aaauu   agggua   c
   ||  |||||||||  ||||||||| ||||| |||||   ||||||   a
3' gg  cucaagggg  uugugaagu auccu uuuaa   ucccau   u
     gu         gu         c     a     ---      gua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 27779990-27780084 [-]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR395k
ppe-MIR395fchrG1: 27781156-27781289 [+]
ppe-MIR395kchrG1: 27779990-27780084 [-]
ppe-MIR395bchrG1: 27773971-27774095 [+]
Database links

Mature sequence ppe-miR395k

Accession MIMAT0031489
Sequence

71 -  

cugaaguguuugggggaacuc

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).