![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ppe-MIR395l |
||||||||||
Accession | MI0026114 (change log) | |||||||||
Description | Prunus persica miR395l stem-loop | |||||||||
Gene family | MIPF0000016; MIR395 | |||||||||
Literature search |
![]()
3 open access papers mention ppe-MIR395l | |||||||||
Stem-loop |
a ug c u --a cuu 5' ucaggugucaccu gaguuccuc a cacuuca uggga auagu c ||||||||||||| ||||||||| | ||||||| ||||| ||||| u 3' aguuuacggugga cucaagggg u gugaagu auccu uauca u c gu u c aca aug |
|||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence ppe-miR395l |
|
Accession | MIMAT0031490 |
Sequence |
69 - cugaaguguuugggggaacuc - 89 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22909020
"Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs"
BMC Plant Biol. 12:149(2012).
|