Stem-loop sequence ppe-MIR399n

AccessionMI0026134 (change log)
DescriptionPrunus persica miR399n stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention ppe-MIR399n
(5 sentences)

Stem-loop 
   ca       g      c       u   -    u    uu    a   uucc    gg  - u 
5'   gggcaaa ucuccu uggcaug ggc cacu acaa  auaa ugc    ggcu  gc c c
     ||||||| |||||| ||||||| ||| |||| ||||  |||| |||    ||||  || | a
3'   cucguuu agagga accguau ucg guga uguu  uauu acg    ccga  cg g g
   gg       -      a       u   u    -    cu    -   --uu    aa  a u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG3: 5253496-5253617 [-]
intergenic
Database links

Mature sequence ppe-miR399n

Accession MIMAT0031510
Sequence

102 -  

ugccaaaggagauuugcucgg

 - 122

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).