![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ppe-MIR2111a |
||||||||
Accession | MI0026141 (change log) | |||||||
Description | Prunus persica miR2111a stem-loop | |||||||
Gene family | MIPF0000754; MIR2111 | |||||||
Stem-loop |
a u ca u a - uuuau 5' gu aggau ggguaaucug uccugagg uua au caac a || ||||| |||||||||| |||||||| ||| || |||| u 3' ca uccua uccauuagac ggggcucc gau ua guug a c c cg c c u uuuau |
|||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence ppe-miR2111a |
|
Accession | MIMAT0031517 |
Sequence |
13 - uaaucugcauccugagguuua - 33 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22909020
"Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs"
BMC Plant Biol. 12:149(2012).
|