Stem-loop sequence ppe-MIR2111a

AccessionMI0026141 (change log)
DescriptionPrunus persica miR2111a stem-loop
Gene family MIPF0000754; MIR2111
Stem-loop
     a     u          ca        u   a  -    uuuau 
5' gu aggau ggguaaucug  uccugagg uua au caac     a
   || ||||| ||||||||||  |||||||| ||| || ||||     u
3' ca uccua uccauuagac  ggggcucc gau ua guug     a
     c     c          cg        c   c  u    uuuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG4: 5127334-5127427 [-]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR2111a
ppe-MIR2111bchrG4: 5129138-5129333 [+]
ppe-MIR2111achrG4: 5127334-5127427 [-]
ppe-MIR2111cchrG4: 5127105-5127182 [-]
Database links

Mature sequence ppe-miR2111a

Accession MIMAT0031517
Sequence

13 - 

uaaucugcauccugagguuua

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).