Stem-loop sequence ppe-MIR2111c

AccessionMI0026143 (change log)
DescriptionPrunus persica miR2111c stem-loop
Gene family MIPF0000754; MIR2111
Stem-loop
                  ug   u      -    uucauu 
5' ggguaaucugcaucc  agg uuagau caac      a
   |||||||||||||||  ||| |||||| ||||      u
3' uccauuagacguagg  ucc gaucua guug      a
                  gu   c      u    uuaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG4: 5127105-5127182 [-]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR2111c
ppe-MIR2111bchrG4: 5129138-5129333 [+]
ppe-MIR2111achrG4: 5127334-5127427 [-]
ppe-MIR2111cchrG4: 5127105-5127182 [-]
Database links

Mature sequence ppe-miR2111c

Accession MIMAT0031519
Sequence

4 - 

uaaucugcauccugagguuua

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).