Stem-loop sequence ppe-MIR8122

AccessionMI0026146 (change log)
DescriptionPrunus persica miR8122 stem-loop
Stem-loop
   -c u     u  u                          c                     g            -  uc     g 
5'   g agucg cu cguugaagucuuuccacagaucuuuc ucauuuugacaauuccgguga ggcagauugaag ca  uguuu u
     | ||||| || |||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||  ||||| u
3'   c ucagu ga gcaacuucagaaagguguuuagaagg aguaaaacuguuaaggccacu ccgucuaacuuc gu  acgaa c
   gu -     -  -                          a                     g            c  cu     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG7: 18519873-18520040 [-]
intergenic
Database links

Mature sequence ppe-miR8122-5p

Accession MIMAT0031523
Sequence

24 - 

uuccacagaucuuuccucauu

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR8122-3p

Accession MIMAT0031524
Sequence

129 - 

ugaaggaagauuuguggaaag

 - 149

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).