Stem-loop sequence ppe-MIR8125

AccessionMI0026151 (change log)
DescriptionPrunus persica miR8125 stem-loop
Stem-loop
                       a  u    u    cggu 
5' ugcucgucacauucuuuccu cc uacu ucac    g
   |||||||||||||||||||| || |||| ||||    u
3' augaguaguguaagaaagga gg auga agug    g
                       c  u    u    uagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG2: 4644770-4644846 [+]
intergenic
Database links

Mature sequence ppe-miR8125

Accession MIMAT0031533
Sequence

57 - 

caggaaagaaugugaugagua

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).