Stem-loop sequence ppe-MIR7125

AccessionMI0026153 (change log)
DescriptionPrunus persica miR7125 stem-loop
Gene family MIPF0001851; MIR7125
Stem-loop
         aagcc       uc     c       g     c      a  c      --u   u 
5' gugacg     aaagcuc  aaaug aagcuag ugcaa aaguuc au uuuaug   ggc g
   ||||||     |||||||  ||||| ||||||| ||||| |||||| || ||||||   |||  
3' cacugu     uuucgag  uuuac uucgauc acguu uucaag ua gaauau   ccg g
         -aaua       uu     u       a     a      c  c      ucc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG4: 6342132-6342256 [+]
intergenic
Database links

Mature sequence ppe-miR7125-5p

Accession MIMAT0031536
Sequence

29 - 

gcuaggugcaacaaguucaau

 - 49

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR7125-3p

Accession MIMAT0031537
Sequence

80 - 

cgaacuuauugcaacuagcuu

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).