Stem-loop sequence ppe-MIR8126

AccessionMI0026154 (change log)
DescriptionPrunus persica miR8126 stem-loop
Stem-loop
        -      ---uu     uu    g      uu  auc       ac   a             u         u  aaac    --    ----u g 
5' cuacu uuacuc     gugcu  agga guuuuu  ua   uucccgu  cac uuucugagucaga uacugaaua ca    accu  uuca     c g
   ||||| ||||||     |||||  |||| ||||||  ||   |||||||  ||| ||||||||||||| ||||||||| ||    ||||  ||||     |  
3' gauga agugag     uaugg  uuuu uaaagg  au   aagggug  gug aaagacucaguuu augacuuau gu    ugga  aagu     g a
        c      ucuuu     --    g      cu  ---       cu   g             u         c  ----    ua    ucugu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG6: 8374973-8375159 [+]
intergenic
Database links

Mature sequence ppe-miR8126-5p

Accession MIMAT0031538
Sequence

54 - 

ucugagucagauuacugaaua

 - 74

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR8126-3p

Accession MIMAT0031539
Sequence

117 - 

uucaguauuuugacucagaa

 - 136

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).