Stem-loop sequence ppe-MIR477

AccessionMI0026155 (change log)
DescriptionPrunus persica miR477 stem-loop
Gene family MIPF0000216; MIR477
Stem-loop
              -   gcuc        u          u   aa     g 
5' aaggcauuuuu guu    acucuccc caaaggcuuc agc  uguca a
   ||||||||||| |||    |||||||| |||||||||| |||  |||||  
3' uucuguaaaaa caa    ugagaggg guuuccgaag ucg  gcggu a
              a   ---a        -          c   -a     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG5: 11887689-11887784 [+]
intergenic
Database links

Mature sequence ppe-miR477-5p

Accession MIMAT0031540
Sequence

19 - 

acucucccucaaaggcuucuag

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR477-3p

Accession MIMAT0031541
Sequence

62 - 

cgaagccuuuggggagaguaa

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).