Stem-loop sequence ppe-MIR6267c

AccessionMI0026156 (change log)
DescriptionPrunus persica miR6267c stem-loop
Stem-loop
           u                 g           c          u  aug    c   aua 
5' gcuauuug aacacauuuacugacca auugcugauca cucucuaaua ag   ggcc cac   u
   |||||||| ||||||||||||||||| ||||||||||| |||||||||| ||   |||| |||    
3' cgauaaac uuguguaaaugauuggu uaacgacuggu gagagauuau uc   ccgg gug   a
           c                 g           a          c  -ca    a   guc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG4: 14236174-14236306 [+]
intergenic
Database links

Mature sequence ppe-miR6267c-5p

Accession MIMAT0031542
Sequence

28 - 

auugcugaucaccucucuaau

 - 48

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR6267c-3p

Accession MIMAT0031543
Sequence

88 - 

uagagagauggucagcaaugu

 - 108

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).