Stem-loop sequence ppe-MIR6291c

AccessionMI0026157 (change log)
DescriptionPrunus persica miR6291c stem-loop
Gene family MIPF0001656; MIR6267
Stem-loop
                                      a  g          au 
5' aaugcuaggaagaccacauuuauagauuaccuugu ua caccucucua  a
   ||||||||||||||||||||||||||||||||||| || ||||||||||  g
3' uuacgauccuucugguguaaauauuugauggaaca au guggagaggu  a
                                      c  g          ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG7: 10789586-10789690 [-]
intergenic
Database links

Mature sequence ppe-miR6291c-5p

Accession MIMAT0031544
Sequence

14 - 

ccacauuuauagauuaccuug

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR6291c-3p

Accession MIMAT0031545
Sequence

72 - 

caagguaguuuauaaaugugg

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).