Stem-loop sequence ppe-MIR8127

AccessionMI0026158 (change log)
DescriptionPrunus persica miR8127 stem-loop
Stem-loop
                  g      c      g       c       gc               ca                ggacauauagucuccaacccauuuccugcu 
5' uccaucccauuuccu cuuugg uucugg uucuugc agaaggu  ugaggcaacugugga  uacccuuugaaaaaau                              u
   ||||||||||||||| |||||| |||||| ||||||| |||||||  |||||||||||||||  ||||||||||||||||                               
3' agguaggguaaagga ggaacc gggacc aagaacg ucuucca  guuccguugacaccu  augggaaacuuuuuua                              u
                  g      u      g       a       aa               ac                acuguugaacuuccgacguacacuaaacga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG2: 22081974-22082195 [+]
intergenic
Database links

Mature sequence ppe-miR8127-5p

Accession MIMAT0031546
Sequence

53 - 

caacuguggacauacccuuug

 - 73

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR8127-3p

Accession MIMAT0031547
Sequence

148 - 

uucaaaggguacauccacagu

 - 168

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).