Stem-loop sequence ppe-MIR8128

AccessionMI0026160 (change log)
DescriptionPrunus persica miR8128 stem-loop
Stem-loop
           g c     aauug          -  ucuu g     g       cag       c       g      ccuauc   g 
5' aaaccucu c gacga     cgucggcaca gu    u ccggc aaauuug   gauuaga cucuccc acgaaa      ucu c
   |||||||| | |||||     |||||||||| ||    | ||||| |||||||   ||||||| ||||||| ||||||      ||| c
3' uuuggaga g cugcu     gcagucgugu ca    a ggccg uuuaaac   cuaaucu gagaggg ugcuuu      aga g
           g a     gauaa          u  -uau g     g       aag       a       g      ----ca   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG7: 17931443-17931615 [-]
intergenic
Database links

Mature sequence ppe-miR8128-5p

Accession MIMAT0031550
Sequence

57 - 

auuagaccucucccgacgaaa

 - 77

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR8128-3p

Accession MIMAT0031551
Sequence

99 - 

ucguggggagagaucuaaucg

 - 119

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).