Stem-loop sequence ppe-MIR8129

AccessionMI0026162 (change log)
DescriptionPrunus persica miR8129 stem-loop
Stem-loop
          -au   uu      u   ccg        c                        u   -aacag  aggaaaau 
5' uauauau   cag  auucuc uau   gauauccg acauuauuauuguguggaugcuau gua      gc        a
   |||||||   |||  |||||| |||   |||||||| |||||||||||||||||||||||| |||      ||        g
3' auauaua   guc  uaagag aug   cuguaggc uguaauaauagcacgccugcggua cau      ug        g
          cau   uu      u   caa        c                        -   aaaaca  auggggag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG6: 21765562-21765723 [+]
intergenic
Database links

Mature sequence ppe-miR8129-5p

Accession MIMAT0031554
Sequence

28 - 

gauauccgcacauuauuauug

 - 48

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR8129-3p

Accession MIMAT0031555
Sequence

116 - 

auaauaauguccggaugucaa

 - 136

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).