Stem-loop sequence ppe-MIR8131

AccessionMI0026164 (change log)
DescriptionPrunus persica miR8131 stem-loop
Stem-loop
          u                  uuc       caaaa  a 
5' gagcuca uucagcuaaguugaguug   ugccaau     ug g
   ||||||| ||||||||||||||||||   |||||||     || u
3' cuugagu aagucgauucgacucaac   acgguua     ac c
          c                  uaa       -aagg  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG3: 18777084-18777173 [+]
intergenic
Database links

Mature sequence ppe-miR8131-5p

Accession MIMAT0031558
Sequence

7 - 

auuucagcuaaguugaguugu

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR8131-3p

Accession MIMAT0031559
Sequence

62 - 

aaucaacucagcuuagcugaacug

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).