Stem-loop sequence ppe-MIR6288b

AccessionMI0026165 (change log)
DescriptionPrunus persica miR6288b stem-loop
Gene family MIPF0001696; MIR6288
Stem-loop
             u                            uguguu 
5' cuaaaacuag uacuuguuauuuuuuaauugauucuuag      a
   |||||||||| ||||||||||||||||||||||||||||       
3' gguuuugauc gugaauaguaaaagauuaacuaagaauc      a
             c                            uuuuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG6: 7137462-7137553 [+]
intergenic
Database links

Mature sequence ppe-miR6288b-5p

Accession MIMAT0031560
Sequence

14 - 

cuuguuauuuuuuaauugauu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR6288b-3p

Accession MIMAT0031561
Sequence

61 - 

ucaauuagaaaaugauaagug

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).