Stem-loop sequence ppe-MIR8132

AccessionMI0026166 (change log)
DescriptionPrunus persica miR8132 stem-loop
Stem-loop
   u            c       aguaaauucaacgauuuacucacucuugcacuc 
5'  uguggucauuca cguugga                                 u
    |||||||||||| |||||||                                  
3'  acaccagugggu gcaaccu                                 u
   a            a       auuauuagguuaccaaguuuuuucaaagaauuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG7: 16161337-16161446 [-]
intergenic
Database links

Mature sequence ppe-miR8132

Accession MIMAT0031562
Sequence

90 - 

uccaacgaugggugaccacaa

 - 110

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).