Stem-loop sequence ppe-MIR8133

AccessionMI0026167 (change log)
DescriptionPrunus persica miR8133 stem-loop
Literature search

1 open access papers mention ppe-MIR8133
(3 sentences)

Stem-loop
            a   aua            a    c a              a g  c     -   uuuucuaccacuccuc 
5' uauauauau cag   uucuccugugcg acgu c gaaguuauuacugu c ga gccau gua                c
   ||||||||| |||   |||||||||||| |||| | |||||||||||||| | || ||||| |||                 
3' guauauaug guc   aaggggauacgc ugca g cuucaauaauggua g cu cggua cau                c
            -   aag            c    a c              c g  a     a   uugucccuccuuuacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 498109-498270 [+]
intergenic
Database links

Mature sequence ppe-miR8133-5p

Accession MIMAT0031563
Sequence

20 - 

uccugugcgaacguccagaag

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR8133-3p

Accession MIMAT0031564
Sequence

121 - 

uaacuuccgaacguccgcaua

 - 141

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).