Stem-loop sequence ppe-MIR6288c

AccessionMI0026168 (change log)
DescriptionPrunus persica miR6288c stem-loop
Gene family MIPF0001696; MIR6288
Stem-loop
                                a       --u  gu 
5' aaaacuagccacuuguuauuuuuuaauug uucuuau   gu  u
   ||||||||||||||||||||||||||||| |||||||   ||   
3' uuuugaucggugaacaauaaaagauuaac aagaaua   ua  a
                                c       uuu  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG6: 9984634-9984721 [-]
intergenic
Database links

Mature sequence ppe-miR6288c-5p

Accession MIMAT0031565
Sequence

12 - 

cuuguuauuuuuuaauugauu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR6288c-3p

Accession MIMAT0031566
Sequence

57 - 

aaccaauuagaaaauaacaagugg

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).