Stem-loop sequence cfa-mir-1185

AccessionMI0027980 (change log)
DescriptionCanis familiaris miR-1185 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   ---gguccucacuggagcugcuc        u    -     ga a              a  uua 
5'                        uuugguac ugaa gagag  u cccuuuguauguuc cu   u
                          |||||||| |||| |||||  | |||||||||||||| ||    
3'                        aaacuaug guuu uucuc  a gggggacauauaag gg   u
   aggcucgcggaagggccagucuc        c    a     ag -              c  uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69273204-69273332 [+]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-1185
cfa-mir-543chr8: 69263406-69263463 [+]
cfa-mir-495chr8: 69265169-69265226 [+]
cfa-mir-3958chr8: 69267134-69267274 [+]
cfa-mir-376a-3chr8: 69269752-69269810 [+]
cfa-mir-376cchr8: 69270100-69270185 [+]
cfa-mir-376a-2chr8: 69270499-69270556 [+]
cfa-mir-376bchr8: 69270858-69270956 [+]
cfa-mir-376a-1chr8: 69271259-69271316 [+]
cfa-mir-300chr8: 69271815-69271892 [+]
cfa-mir-1185chr8: 69273204-69273332 [+]
cfa-mir-381chr8: 69274983-69275057 [+]
cfa-mir-487bchr8: 69275496-69275553 [+]
cfa-mir-539chr8: 69276311-69276386 [+]
cfa-mir-889chr8: 69276842-69276980 [+]
cfa-mir-544chr8: 69277656-69277744 [+]
cfa-mir-487achr8: 69281078-69281157 [+]
cfa-mir-382chr8: 69283123-69283179 [+]
Database links

Mature sequence cfa-miR-1185

Accession MIMAT0034383
Sequence

73 - 

auauacagggggagacucuuau

 - 94

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).