Stem-loop sequence efu-mir-429

AccessionMI0028699 (change log)
DescriptionEptesicus fuscus miR-429 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   -u   -       u -          cg       cu   u 
5'   gug augggcg c uuaccagaca  guuagac  ggg c
     ||| ||||||| | ||||||||||  |||||||  |||  
3'   cac uaccugc g aauggucugu  uaaucug  ucu c
   gg   c       c u          ca       --   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977681.1: 209798-209876 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-429
efu-mir-200bJH977681.1: 208041-208120 [+]
efu-mir-200aJH977681.1: 208600-208681 [+]
efu-mir-429JH977681.1: 209798-209876 [+]
Database links

Mature sequence efu-miR-429

Accession MIMAT0035014
Sequence

47 - 

cuaauacugucugguaaugccgu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).