Stem-loop sequence sly-MIR319b

AccessionMI0029098 (change log)
DescriptionSolanum lycopersicum miR319b stem-loop
Gene family MIPF0000010; MIR159
Literature search

22 open access papers mention sly-MIR319b
(164 sentences)

Stem-loop
   gu    ---------u   u     uu       ugu    --u   uguaa  -u      u    u   a                 cu          cg     uuu     -        ac        u  aa        --g   uau 
5'   cccc          uuu uaaga  cuaauuu   gauu   aga     ug  ggaaga ggua aag gagcuuccuuuagucca  cauagguaga  aagga   gaauu aucucccg  ucauucau ca  cgcaauag   aag   g
     ||||          ||| |||||  |||||||   ||||   |||     ||  |||||| |||| ||| |||||||||||||||||  ||||||||||  |||||   ||||| ||||||||  |||||||| ||  ||||||||   |||    
3'   gggg          aag auucu  gguuaag   cuga   ucu     gc  cuuucu ccau uuc cucgagggaagucaggu  gugucuauuu  uuccu   cuuaa uagagggc  aguaagug gu  guguuauc   uuc   u
   -c    uuuguugauu   u     uu       ---    uuu   --uug  uu      u    u   c                 uc          --     -cu     a        gu        u  aa        aua   uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr6: 1551676-1551967 [+]
intergenic
Database links

Mature sequence sly-miR319b

Accession MIMAT0035430
Sequence

209 - 

uuggacugaagggagcucccu

 - 229

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).