Stem-loop sequence sly-MIR9477

AccessionMI0029119 (change log)
DescriptionSolanum lycopersicum miR9477 stem-loop
Literature search

2 open access papers mention sly-MIR9477
(3 sentences)

Stem-loop
        -uc   u  gg      a   gg        a    au                            c   c            c               u    -     au 
5' guuaa   uau ga  gagugu ucc  uuuuucga uuuu  aucugaacuaucacuaaguguuuaucga aca accucaacuauc guuguucccuuuucc accu gaaug  g
   |||||   ||| ||  |||||| |||  |||||||| ||||  |||||||||||||||||||||||||||| ||| |||||||||||| ||||||||||||||| |||| |||||  g
3' caguu   gug cu  uucaua agg  aaaaggcu aagg  uggacuugauagugguuuacaaauagcu ugu uggaguugauag caacaagggaaaggg ugga cuuau  u
        uuu   u  ag      -   -a        c    gu                            u   a            u               u    u     ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr6: 43739860-43740092 [+]
intergenic
Database links

Mature sequence sly-miR9477-5p

Accession MIMAT0035471
Sequence

84 - 

uauccguuguucccuuuuccuacc

 - 107

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR9477-3p

Accession MIMAT0035472
Sequence

130 - 

uugggaaagggaacaacugauagu

 - 153

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).