Stem-loop bdi-MIR399c

Accession

MI0029163

Description

Brachypodium distachyon bdi-MIR399c precursor miRNA

Gene family

MIPF0000015; MIR399

Literature search

3 open access papers mention bdi-MIR399c
(8 sentences)

Sequence

gaaucccagggcgcuucuccuuuggcacgguggcauguaccugcaauggagucagccaggugaggaugcaggugaagcuccaggcuuccguggugcagcucgcaagccgugcgUGCCAAAGGAGAAUUGCCCUGcgauuc
(((((.(((((((.(((((((((((((((.((((.(((..((((((((((...((((..(.(((.............)))).)))))))))..)))))...))).))))..))))))))))))))).))))))).)))))

Structure

     c       c               -g    a   -ac     --     guc    ag u   gaugc 
gaauc cagggcg uucuccuuuggcacg  uggc ugu   cugca  augga   agcc  g gag     a
||||| ||||||| |||||||||||||||  |||| |||   |||||  |||||   ||||  | |||     g
cuuag GUCCCGU AAGAGGAAACCGUgc  gccg acg   gacgu  ugccu   ucgg  c cuc     g
     c       U               gu    a   cuc     gg     ---    -a -   gaagu 

Annotation confidence Not enough data

Genome context

2: 16765663-16765802 [+]

Mature bdi-miR399c

• Accession: MIMAT0035521
• Description: Brachypodium distachyon bdi-miR399c mature miRNA
• Sequence: 114 - UGCCAAAGGAGAAUUGCCCUG - 134
• Evidence: not_experimental

References

1. PubMed ID: 24367943
   Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon
   Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ
   Genome Biol (2013) 14:R145