Stem-loop sequence tae-MIR9663

AccessionMI0030383 (change log)
DescriptionTriticum aestivum miR9663 stem-loop
Literature search

1 open access papers mention tae-MIR9663
(1 sentences)

Stem-loop
   -aa   a  cu  g    c     c     c           -------  guu 
5'    gag ag  ug ucau uaaag guagu gaacgaaucug       cc   g
      ||| ||  || |||| ||||| ||||| |||||||||||       ||    
3'    cuc uc  ac agua auuuc cauua cuugcuuagac       gg   a
   cca   a  ag  g    c     a     u           uuguaua  agu 
Get sequence
Deep sequencing
544234 reads, 2.46e+03 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
6B: 12097776-12097877 [+]
intergenic
Database links

Mature sequence tae-miR9663-5p

Accession MIMAT0035773
Sequence

21 - 

aagcguagucgaacgaaucug

 - 41

Get sequence
Deep sequencing544158 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).