Stem-loop sequence tae-MIR1137b

AccessionMI0030384 (change log)
DescriptionTriticum aestivum miR1137b stem-loop
Gene family MIPF0000443; MIR1120
Literature search

6 open access papers mention tae-MIR1137b
(7 sentences)

Stem-loop
   uuga   auc       c             -      a     a 
5'     ucu   uccguuc agaauagaugacc aacuuu uacua a
       |||   ||||||| ||||||||||||| |||||| |||||  
3'     agg   aggcaag uuuuaucuauugg uugaaa augau a
   caug   --a       a             g      c     u 
Get sequence
Deep sequencing
145147 reads, 585 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR1137b-5p

Accession MIMAT0035774
Sequence

11 - 

uccguuccagaauagaugacc

 - 31

Get sequence
Deep sequencing122388 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).