Stem-loop sequence tae-MIR9665

AccessionMI0030386 (change log)
DescriptionTriticum aestivum miR9665 stem-loop
Literature search

1 open access papers mention tae-MIR9665
(1 sentences)

Stem-loop
   -    a  u        c                  g   u              u        g 
5'  uaau au ugguuuga uuugcacugcuagcggug cac gccgcacugcccgg caguguaa c
    |||| || |||||||| |||||||||||||||||| ||| |||||||||||||| |||||||| u
3'  auua ua acuaaacu aaaugugacgaucgucac gug cggcgugacgggcc gucacauu c
   c    c  u        c                  -   c              u        a 
Get sequence
Deep sequencing
121 reads, 0 reads per million, 92 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9665-3p

Accession MIMAT0035776
Sequence

100 - 

gcuagcaguguaaacucaaauca

 - 122

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).