Stem-loop sequence tae-MIR9673

AccessionMI0030401 (change log)
DescriptionTriticum aestivum miR9673 stem-loop
Literature search

1 open access papers mention tae-MIR9673
(1 sentences)

Stem-loop
   -  c       -       c   u          gga g aagaa 
5'  cg cucgagg uaagaag aaa agcacaugca   g u     a
    || ||||||| ||||||| ||| ||||||||||   | |      
3'  gc gagcucc auucuuc uuu ucgugugcgu   c a     g
   g  c       c       c   c          aag g acgaa 
Get sequence
Deep sequencing
6148 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9673-5p

Accession MIMAT0035791
Sequence

11 - 

uaagaagcaaauagcacaug

 - 30

Get sequence
Deep sequencing1596 reads, 115 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).