Stem-loop sequence tae-MIR9674b

AccessionMI0030411 (change log)
DescriptionTriticum aestivum miR9674b stem-loop
Gene family MIPF0001917; MIR9674
Literature search

2 open access papers mention tae-MIR9674b
(2 sentences)

Stem-loop
   -   c cg c          u     c     uuca  g    uugc 
5'  gaa u  u cauagcauca ccauc uaccc    ac gugg    c
    ||| |  | |||||||||| ||||| |||||    || ||||    g
3'  cuu a  a guaucguagu gguag auggg    ug cacc    a
   a   c au a          c     a     ----  g    ccuu 
Get sequence
Deep sequencing
1740836 reads, 8.34e+03 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9674b-5p

Accession MIMAT0035801
Sequence

11 - 

auagcaucauccauccuaccc

 - 31

Get sequence
Deep sequencing1740282 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).