Stem-loop sequence chi-mir-10a

AccessionMI0030596 (change log)
DescriptionCapra hircus miR-10a stem-loop
Gene family MIPF0000033; mir-10
Literature search

5 open access papers mention chi-mir-10a
(7 sentences)

Stem-loop
   -------a  aa  uc   --c    uu        a    g     c          uaaggaa 
5'         ag  ga  ugu   uguc  cuguauau cccu uagau cgaauuugug       u
           ||  ||  |||   ||||  |||||||| |||| ||||| ||||||||||        
3'         uc  cu  aca   acag  gauguaua gggg aucua gcuuaaacac       u
   uuuuuuac  gc  -c   aau    uu        a    -     u          uaguguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr19: 39033927-39034047 [+]
intergenic
Database links

Mature sequence chi-miR-10a-5p

Accession MIMAT0035911
Sequence

27 - 

uacccuguagauccgaauuugu

 - 48

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-10a-3p

Accession MIMAT0035912
Sequence

68 - 

caaauucguaucuaggggaau

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).