Stem-loop sequence chi-mir-188

AccessionMI0030659 (change log)
DescriptionCapra hircus miR-188 stem-loop
Gene family MIPF0000113; mir-188
Literature search

1 open access papers mention chi-mir-188
(4 sentences)

Stem-loop
   --------------uucccu    -  uc   ca  uc         gu      -ugag u 
5'                     gcuc cc  ucu  ca  ccuugcaug  ggaggg     c u
                       |||| ||  |||  ||  |||||||||  ||||||     | u
3'                     cgag gg  agg  gu  gggacguac  ccuccc     g c
   ucucucguucuuuucggcuc    u  -u   ac  uu         ac      caaaa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 82619878-82619987 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-188
chi-mir-532chrX: 82620208-82620308 [-]
chi-mir-188chrX: 82619878-82619987 [-]
Database links

Mature sequence chi-miR-188-5p

Accession MIMAT0036013
Sequence

20 - 

caucccuugcaugguggaggg

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-188-3p

Accession MIMAT0036014
Sequence

59 - 

cucccacaugcaggguuugca

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).