Stem-loop sequence chi-mir-190a

AccessionMI0030662 (change log)
DescriptionCapra hircus miR-190a stem-loop
Gene family MIPF0000076; mir-190
Literature search

1 open access papers mention chi-mir-190a
(1 sentences)

Stem-loop
   ---------------------------accuggaugccuuucugca   cu    - ug               ua     uuau 
5'                                               ggc  cugu g  auauguuugauauau  gguug    u
                                                 |||  |||| |  |||||||||||||||  |||||     
3'                                               cug  gaca c  uauacaaacuauaua  ucaac    u
   ggacaacggaauacucgauauaauccuugggggccucugucccguu   -u    u cu               --     cuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr10: 45829591-45829731 [-]
intergenic
Database links

Mature sequence chi-miR-190a-5p

Accession MIMAT0036019
Sequence

30 - 

ugauauguuugauauauuagguu

 - 52

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-190a-3p

Accession MIMAT0036020
Sequence

67 - 

cuauauaucaaacauauuccu

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).