Stem-loop sequence chi-mir-450

AccessionMI0030797 (change log)
DescriptionCapra hircus miR-450 stem-loop
Gene family MIPF0000128; mir-450
Stem-loop
   caaagaaa     u       uuu     u               aa 
5'         gaugc aaacuau   ugcga guguuccuaauaugu  u
           ||||| |||||||   ||||| |||||||||||||||  c
3'         cuaug uuugaua   acguu uacaaggguuaugua  u
   ----auaa     u       cuu     u               aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 40339836-40339928 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-450
chi-mir-424chrX: 40346458-40346566 [-]
chi-mir-542chrX: 40340880-40340988 [-]
chi-mir-450chrX: 40339836-40339928 [-]
Database links

Mature sequence chi-miR-450-5p

Accession MIMAT0036235
Sequence

22 - 

uuuugcgauguguuccuaau

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-450-3p

Accession MIMAT0036236
Sequence

57 - 

auugggaacauuuugcau

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).