Stem-loop sequence chi-mir-502b

AccessionMI0030815 (change log)
DescriptionCapra hircus miR-502b stem-loop
Gene family MIPF0000139; mir-500
Stem-loop
       c - uc  -u         ucc       a  g   uuu 
5' gcuc c c  uc  aauucuugc   ccaggug ga ugc   g
   |||| | |  ||  |||||||||   ||||||| || |||   u
3' cgag g g  ag  uuaggaacg   gguccac cu acg   g
       a u ua  uc         ---       -  a   uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 82604898-82604980 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-502b
chi-mir-502bchrX: 82604898-82604980 [-]
chi-mir-362chrX: 82604414-82604511 [-]
chi-mir-500chrX: 82603133-82603216 [-]
chi-mir-660chrX: 82601027-82601104 [-]
chi-mir-502achrX: 82599100-82599184 [-]
Database links

Mature sequence chi-miR-502b-5p

Accession MIMAT0036266
Sequence

12 - 

uaauucuugcuccccaggugag

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-502b-3p

Accession MIMAT0036267
Sequence

51 - 

auccaccugggcaaggauucugaa

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).