Stem-loop sequence chi-mir-660

AccessionMI0030828 (change log)
DescriptionCapra hircus miR-660 stem-loop
Gene family MIPF0000113; mir-188
Literature search

1 open access papers mention chi-mir-660
(3 sentences)

Stem-loop
   cugcuccuu    c   -c    u      c    c   gaau 
5'          cucc gua  ccau gcauau ggag ugu    g
            |||| |||  |||| |||||| |||| |||    c
3'          gagg cau  ggua cgugua ccuc acg    u
   ---------    a   ua    -      u    c   aaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 82601027-82601104 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-660
chi-mir-502bchrX: 82604898-82604980 [-]
chi-mir-362chrX: 82604414-82604511 [-]
chi-mir-500chrX: 82603133-82603216 [-]
chi-mir-660chrX: 82601027-82601104 [-]
chi-mir-502achrX: 82599100-82599184 [-]
Database links

Mature sequence chi-miR-660

Accession MIMAT0036284
Sequence

16 - 

uacccauugcauaucggagcugu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).