Stem-loop sequence chi-mir-93

AccessionMI0030841 (change log)
DescriptionCapra hircus miR-93 stem-loop
Gene family MIPF0000001; mir-17
Literature search

2 open access papers mention chi-mir-93
(2 sentences)

Stem-loop
   cugg      -ca        -    u    g   u  g u 
5'     gggcuc   aagugcug uucg gcag uag gu a c
       ||||||   |||||||| |||| |||| ||| || | a
3'     cccgag   uucacgac gagu cguc auc ca u c
   ----      ccc        c    -    -   -  g c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence chi-miR-93-5p

Accession MIMAT0036305
Sequence

11 - 

caaagugcuguucgugcagguag

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-93-3p

Accession MIMAT0036306
Sequence

50 - 

acugcugagccagcacuucccga

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).