Stem-loop sequence gma-MIR319o

Accession

MI0031039 (change log)

Description

Glycine max miR319o stem-loop

Gene family

MIPF0000010; MIR159

Literature search

17 open access papers mention gma-MIR319o
(42 sentences)

Stem-loop

   g    u            -     c   u       uuc     auuaaa    u  u        ug   ac           cac   g  c     gcu 
5'  agag gaaggagcuucc uucag cca gcaugga   aaggg      gggu gc ggaguauc  cug  ucauucauaca   aca ua guagu   u
    |||| |||||||||||| ||||| ||| |||||||   |||||      |||| || ||||||||  |||  |||||||||||   ||| || |||||    
3'  ucuu cuuccucgaggg aaguc ggu cgugucu   uucuc      ccca cg uuuuauag  gac  aguaagugugu   ugu au cguua   u
   -    u            g     a   u       cuu     ------    -  -        ug   ga           uaa   g  -     aac 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Glycine_max_v2.0; GCA_000004515.3): chr6: 11459824-11460018 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0031039

Mature sequence gma-miR319o

• Accession: MIMAT0036377
• Sequence: 169 - uggacugaaggggagcuccuuc - 190
• Evidence: experimental; Illumina [1]

References

1. PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).