![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR9750 |
|||||
Accession | MI0031040 (change log) | ||||
Description | Glycine max miR9750 stem-loop | ||||
Literature search |
1 open access papers mention gma-MIR9750 | ||||
Stem-loop |
c c - g uauuu ucc aaagaucuggaucgaggaagcagaa 5' auuu agag gcgcguauggacuuac accugaagau cu ugaugaagcu g |||| |||| |||||||||||||||| |||||||||| || |||||||||| 3' uaaa ucuc cguguauaccugaaug uggacuucua ga acuacuucga g - a u - -uuac -cc gaacuucuccucgucaauaugguac |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR9750-5p |
|
Accession | MIMAT0039317 |
Sequence |
9 - aggcgcguauggacuuacgacc - 30 |
Evidence | experimental; Illumina [2] |
Mature sequence gma-miR9750-3p |
|
Accession | MIMAT0036378 |
Sequence |
137 - uguaaguccauaugugcucucu - 158 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|
2 |
PMID:25465409
"An atlas of soybean small RNAs identifies phased siRNAs from hundreds of coding genes"
Plant Cell. 26:4584-4601(2014).
|