Stem-loop sequence tch-mir-200b

AccessionMI0031282 (change log)
DescriptionTupaia chinensis miR-200b stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   -    -    ug     c      u  ug 
5'  cauc uuac  ggcag auugga gg  u
    |||| ||||  ||||| |||||| ||  c
3'  guag aaug  ccguc uaaucu cu  u
   a    u    gu     a      -  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB364377.1: 9043059-9043116 [+]
intergenic
Clustered miRNAs
< 10kb from tch-mir-200b
tch-mir-200bKB364377.1: 9043059-9043116 [+]
tch-mir-200aKB364377.1: 9043899-9043957 [+]
Database links

Mature sequence tch-miR-200b-3p

Accession MIMAT0036612
Sequence

37 - 

uaauacugccugguaaugauga

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1