Stem-loop sequence tae-MIR9672b

AccessionMI0031526 (change log)
DescriptionTriticum aestivum miR9672b stem-loop
Gene family MIPF0001942; MIR9672
Literature search

3 open access papers mention tae-MIR9672b
(4 sentences)

Stem-loop
         gc                              ugaagacgaugcuuaauggcc 
5' gugaag  gaugcuuaaugacagucgugguguccuagg                     a
   ||||||  ||||||||||||||||||||||||||||||                      
3' cacuuc  cuacgaauuacugucagcaccauaggaucu                     g
         ua                              ucucgguccgcugacagaugc 
Get sequence
Deep sequencing
1474719 reads, 6.09e+03 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was incorrectly named MIR2006 in [1].

Genome context
Coordinates Overlapping transcripts
5D: 101564640-101564759 [-]
intergenic
Database links

Mature sequence tae-miR9672b

Accession MIMAT0036984
Sequence

90 - 

uaccacgacugucauuaagca

 - 110

Get sequence
Deep sequencing454084 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19499258 "Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv" Wei B, Cai T, Zhang R, Li A, Huo N, Li S, Gu YQ, Vogel J, Jia J, Qi Y, Mao L Funct Integr Genomics. 9:499-511(2009).