Stem-loop sequence tae-MIR530

AccessionMI0031529 (change log)
DescriptionTriticum aestivum miR530 stem-loop
Gene family MIPF0000521; MIR530
Literature search

3 open access papers mention tae-MIR530
(5 sentences)

Stem-loop
   -   a  g       c     u   ac         g  -    -a  -aa        gcuu     uug  c      -  g 
5'  guu ug gauagag ugcau ugc  cugcaccua ag agga  ga   ggucgagg    ggaac   gc augcau gc a
    ||| || ||||||| ||||| |||  ||||||||| || ||||  ||   ||||||||    |||||   || |||||| ||  
3'  cgg ac cuaucuc acgua acg  gacguggau uc uucu  cu   ccaguucc    ucuug   cg uacgua cg u
   a   -  a       a     u   gu         g  c    cg  cuc        ----     caa  -      g  u 
Get sequence
Deep sequencing
13140 reads, 7.76 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was incorrectly named MIR2011 in [1].

Genome context
Coordinates Overlapping transcripts
2A: 45376849-45377007 [+]
intergenic
Database links

Mature sequence tae-miR530

Accession MIMAT0036987
Sequence

129 - 

ugcaguggcauaugcaacucu

 - 149

Get sequence
Deep sequencing27 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19499258 "Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv" Wei B, Cai T, Zhang R, Li A, Huo N, Li S, Gu YQ, Vogel J, Jia J, Qi Y, Mao L Funct Integr Genomics. 9:499-511(2009).