Stem-loop sequence tae-MIR9778

AccessionMI0031533 (change log)
DescriptionTriticum aestivum miR9778 stem-loop
Literature search

2 open access papers mention tae-MIR9778
(2 sentences)

Stem-loop
       c        a   c        c    --c         - a 
5' gaag ccugcauc ucu gaacucgu ggug   gauagcgug c g
   |||| |||||||| ||| |||||||| ||||   ||||||||| | c
3' cuuc ggacguag aga cuugagca ccac   uugucguac g g
       c        c   c        a    uac         a u 
Get sequence
Deep sequencing
523 reads, 0 reads per million, 113 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was incorrectly named MIR2015 in [1].

Database links

Mature sequence tae-miR9778

Accession MIMAT0036991
Sequence

8 - 

ugcaucaucucgaacucgucg

 - 28

Get sequence
Deep sequencing505 reads, 113 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19499258 "Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv" Wei B, Cai T, Zhang R, Li A, Huo N, Li S, Gu YQ, Vogel J, Jia J, Qi Y, Mao L Funct Integr Genomics. 9:499-511(2009).