Stem-loop sequence tae-MIR9653b

AccessionMI0031538 (change log)
DescriptionTriticum aestivum miR9653b stem-loop
Literature search

2 open access papers mention tae-MIR9653b
(3 sentences)

Stem-loop
      c  c              c ug      
5' cca gg cauggccaaggucu u  aggcu 
   ||| || |||||||||||||| |  |||| u
3' ggu cc guaccgguuucaga a  uccgg 
      a  u              - gu      
Get sequence
Deep sequencing
85244 reads, 307 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was incorrectly named MIR2022 in [1].

Genome context
Coordinates Overlapping transcripts
1D: 134547683-134547742 [+]
intergenic
Database links

Mature sequence tae-miR9653b

Accession MIMAT0036996
Sequence

10 - 

uggccaaggucucuugaggcu

 - 30

Get sequence
Deep sequencing28226 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19499258 "Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv" Wei B, Cai T, Zhang R, Li A, Huo N, Li S, Gu YQ, Vogel J, Jia J, Qi Y, Mao L Funct Integr Genomics. 9:499-511(2009).