Stem-loop sequence api-mir-3055-2

AccessionMI0031732 (change log)
DescriptionAcyrthosiphon pisum miR-3055-2 stem-loop
Gene family MIPF0001909; mir-3055
Stem-loop
   --a               c    u  gau 
5'    ucguuuaucgcgaac gcua gu   u
      ||||||||||||||| |||| ||    
3'    ggcgaauagcgcuug cgau ua   u
   gcc               a    u  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349643.1: 1800731-1800788 [-]
intergenic
Clustered miRNAs
< 10kb from api-mir-3055-2
api-mir-3055-5GL349643.1: 1806105-1806162 [-]
api-mir-3055-4GL349643.1: 1803738-1803795 [-]
api-mir-3055-3GL349643.1: 1802233-1802290 [-]
api-mir-3055-2GL349643.1: 1800731-1800788 [-]
api-mir-3055-1GL349643.1: 1800302-1800359 [-]
Database links

Mature sequence api-miR-3055

Accession MIMAT0014798
Sequence

38 - 

gcaguucgcgauaagcggccg

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).