Stem-loop sequence rno-mir-6317-2

AccessionMI0031775 (change log)
DescriptionRattus norvegicus miR-6317-2 stem-loop
Gene family MIPF0002112; mir-6317
Stem-loop
   aaaga   -  -     -    --cuu    uc  -  g      ac   a   a       g   aa 
5'      ccu cu agucu ccug     gccu  ug cu caguga  cug gag aaggcuc agc  u
        ||| || ||||| ||||     ||||  || || ||||||  ||| ||| ||||||| |||   
3'      gga ga uuagg ggau     uggg  ac ga gucacu  gac cuc uuccggg uug  u
   -----   a  c     u    cuuau    cu  a  g      cu   a   a       g   ga 
Get sequence
Deep sequencing
87 reads, 0 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 259665468-259665594 [-]
sense
ENSRNOT00000075605 ; ALDH18A1-201; intron 2
Database links

Mature sequence rno-miR-6317

Accession MIMAT0025054
Sequence

36 - 

gugaaccugagagaaaggcuc

 - 56

Get sequence
Deep sequencing152 reads, 65 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).