Stem-loop sequence ame-mir-9864

AccessionMI0031788 (change log)
DescriptionApis mellifera miR-9864 stem-loop
Stem-loop
   --   gu            g ug            cacau     aac 
5'   agc  gccucuuucgag c  uuuaaauggauu     ugugc   u
     |||  |||||||||||| |  ||||||||||||     |||||   c
3'   ucg  cggagaaagcuu g  gaauuuaccuaa     auacg   g
   ug   gu            - cu            -----     gca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000055.5: 4683012-4683102 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-9864
ame-mir-6045CM000055.5: 4680746-4680823 [+]
ame-mir-9864CM000055.5: 4683012-4683102 [+]
Database links

Mature sequence ame-miR-9864-5p

Accession MIMAT0037266
Sequence

11 - 

uuucgaggcuguuuaaauggauu

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).