Stem-loop sequence ame-mir-9865

AccessionMI0031791 (change log)
DescriptionApis mellifera miR-9865 stem-loop
Stem-loop
   -aagau    u              -          --------   acaa 
5'       ggaa ugauuuauguggug auugugcagu        agc    u
         |||| |||||||||||||| ||||||||||        |||     
3'       ccuu auuagauacauuac uagcacguca        ucg    u
   aauuau    c              a          ccaaaaag   aaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000057.5: 1797917-1798010 [+]
intergenic
Database links

Mature sequence ame-miR-9865-5p

Accession MIMAT0037269
Sequence

11 - 

ugauuuauguggugauugugc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).