Stem-loop sequence ame-mir-9866

AccessionMI0031792 (change log)
DescriptionApis mellifera miR-9866 stem-loop
Stem-loop
   gau      --   -        c          uaa     uc 
5'    gagagg  auu cgagucgg gggguaugag   uacgu  a
      ||||||  ||| |||||||| ||||||||||   |||||   
3'    cucucc  uaa gcucgguu cccuaugcuc   augua  g
   ucc      cg   c        c          --c     cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000058.5: 5124652-5124736 [+]
intergenic
Database links

Mature sequence ame-miR-9866-5p

Accession MIMAT0037270
Sequence

11 - 

uucgagucggcgggguaugagu

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).