Stem-loop sequence ame-mir-9867

AccessionMI0031793 (change log)
DescriptionApis mellifera miR-9867 stem-loop
Stem-loop
   ucc     caa      -   ga      a      uca 
5'    ugagg   gacggu aug  cgguag gacgag   u
      |||||   |||||| |||  |||||| ||||||    
3'    acucc   uugcca ugc  gccguc cugcuc   g
   ccu     -ua      c   --      -      cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000067.5: 9225723-9225797 [+]
intergenic
Database links

Mature sequence ame-miR-9867-5p

Accession MIMAT0037271
Sequence

11 - 

agacgguauggacgguagagacga

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).